Fig. 8.
Fig. 8. Down-regulation of in vitro DNA-binding activity of STAT3 by BMP-2. / EMSA using untreated U266 nuclear extracts (lane 1) and a radiolabeled STAT3 wild-type probe (GATCCGACATTTCCCGTAAATCG) generated DNA-protein complexes (arrows, lane 2), which were eliminated by a 100-fold molar excess of self-competitor (lane 5), but not by the same molar excess of the mutant STAT3 oligonucleotide that lacks the STAT binding site (lane 6). A similar sequence-specific DNA-binding activity was seen with the use of nuclear extracts from U266 cells treated with BMP-2 for 120 minutes (lanes 7-8). Supershift assays using the radiolabeled STAT3 probe, untreated or BMP-2–treated nuclear extract, and an anti-STAT3 polyclonal antibody eliminated cells that had been treated with a slowly migrating complex (indicated by the asterisk) (lanes 9-10). The uppermost DNA-protein complexes generated by nuclear extract prepared with BMP-2 for either 30 minutes or 120 minutes (lanes 3 and 4, respectively) were lower in intensity compared with those from untreated nuclear extract. The position of the free probe is indicated at the bottom of the gels.

Down-regulation of in vitro DNA-binding activity of STAT3 by BMP-2.

EMSA using untreated U266 nuclear extracts (lane 1) and a radiolabeled STAT3 wild-type probe (GATCCGACATTTCCCGTAAATCG) generated DNA-protein complexes (arrows, lane 2), which were eliminated by a 100-fold molar excess of self-competitor (lane 5), but not by the same molar excess of the mutant STAT3 oligonucleotide that lacks the STAT binding site (lane 6). A similar sequence-specific DNA-binding activity was seen with the use of nuclear extracts from U266 cells treated with BMP-2 for 120 minutes (lanes 7-8). Supershift assays using the radiolabeled STAT3 probe, untreated or BMP-2–treated nuclear extract, and an anti-STAT3 polyclonal antibody eliminated cells that had been treated with a slowly migrating complex (indicated by the asterisk) (lanes 9-10). The uppermost DNA-protein complexes generated by nuclear extract prepared with BMP-2 for either 30 minutes or 120 minutes (lanes 3 and 4, respectively) were lower in intensity compared with those from untreated nuclear extract. The position of the free probe is indicated at the bottom of the gels.

or Create an Account

Close Modal
Close Modal