Fig. 2.
Fig. 2. Abilities of AML1 mutants to bind DNA and to heterodimerize with CBFβ. / (A) DNA binding potential of AML1 mutants analyzed by EMSA using nuclear extract from Cos-7 cells transfected with wild-type AML1 or mutated AML1 expression plasmid vectors. The oligonucleotides used as competitors were as follows: “W” containing one wild-type AML1 binding site (CGAGTATTGTGGTTAATACG); “M” containing one mutated AML1 binding site (CGAGTATTGTTAGTAATACG). (B) Heterodimerization ability of AML1 mutants with CBFβ. Cos-7 cells were cotransfected with an expression vector containing CBFβ cDNA and those containing either wild-type AML1 or mutated AML1 cDNA. Cell lysates were immunoprecipitated (IP) with anti–FLAG M2 antibody, and then proteins were detected by immunoblot analysis (WB) using anti-CBFβ antibody (top). The expression levels of CBFβ and AML1 in total cell lysates were detected by immunoblot analysis with anti-CBFβ antibody (upper middle) and anti–FLAG M2 antibody (lower middle), respectively. The AML1 expression levels also were analyzed by anti-AML1 antibody (bottom). The numbers of AML1 mutants (1-10) are shown in Figure 1.

Abilities of AML1 mutants to bind DNA and to heterodimerize with CBFβ.

(A) DNA binding potential of AML1 mutants analyzed by EMSA using nuclear extract from Cos-7 cells transfected with wild-type AML1 or mutated AML1 expression plasmid vectors. The oligonucleotides used as competitors were as follows: “W” containing one wild-type AML1 binding site (CGAGTATTGTGGTTAATACG); “M” containing one mutated AML1 binding site (CGAGTATTGTTAGTAATACG). (B) Heterodimerization ability of AML1 mutants with CBFβ. Cos-7 cells were cotransfected with an expression vector containing CBFβ cDNA and those containing either wild-type AML1 or mutated AML1 cDNA. Cell lysates were immunoprecipitated (IP) with anti–FLAG M2 antibody, and then proteins were detected by immunoblot analysis (WB) using anti-CBFβ antibody (top). The expression levels of CBFβ and AML1 in total cell lysates were detected by immunoblot analysis with anti-CBFβ antibody (upper middle) and anti–FLAG M2 antibody (lower middle), respectively. The AML1 expression levels also were analyzed by anti-AML1 antibody (bottom). The numbers of AML1 mutants (1-10) are shown in Figure 1.

or Create an Account

Close Modal
Close Modal