Sequence analysis showing ongoing rearrangement in 9 children with B-lineage ALL
Case no. . | VH− gene* . | CDR3 (n-DH-n) . | 5′-JH . | Molecular mechanisms . |
|---|---|---|---|---|
| 99 | VH1-69 | gatcggcggTTGTACTAATGGTGTATGCT (DH2-8) | AAC (JH5) | |
| VH3-52 | gaggct---------------------- (DH2-8) | ---(JH5) | VH-VH replacement | |
| 177 | VH3-11 | agagaccctgaacggTATTTTGACTGGTTATTA (DH3-9) | TTT (JH4) | |
| VH4-39 | cggatg------------------------------ (DH3-9) | ---(JH4) | VH-VH replacement | |
| 190 | VH3-13 | gatcgggagaAT (AGC) 3TGaGATATTGTAGTGGTGGTAGCTGCTAC (DH2-15) | TAC (JH6) | |
| VH1-3 | gatggccc------------------------ (DH2-15) | --- (JH6) | VH-DJH joining | |
| 246 | VH3-74 | gtcgattGGATATTGTAGTAGTACCAGCTGCTAT (DH2-2) | TAC (JH6) | |
| VH1-2 | tcacggacaacgcgacag----------------------- (DH2-2) | ---(JH6) | VH-DJH joining | |
| 266 | VH1-46 | gaaactctaggctaactcggta (n=22 bp) | TGA (JH4) | |
| VH5-51 | cgaaaaa---------------------- (n=29 bp) | --- (JH4) | VH-NJH joining | |
| 269 | VH3-48 | GATATTGTAGTAGTACCAGCTGCTA (DH2-2) | AAC (JH5) | |
| VH4-34 | ggcggacc------------------- (DH2-2) | --- (JH5) | VH-DJH joining | |
| 392 | VH3-23 | ggccgccctacgGTATTACTATGATAGTAGTGGTTATcgg (DH3-22) | CTA (JH4) | |
| VH4-30 | gcccct--------------------------- (DH3-22) | --- (JH4) | VH-DJH joining | |
| 400 | VH4-28 | aatttcttcCTATGATAGTAGTGGTTATTAaaaggggg (DH3-22) | TGG (JH5) | |
| VH3-13 | tggggggg-------------------------- (DH3-22) | --- (JH5) | VH-DJH joining | |
| 214 | VH3-30 | cTAGTAGTACCAGCTGCTATtttggtcggggtg (DH2-2) | ACT (JH6) | |
| VH3-30 | gagggtaggttt-------------------------------- (DH2-2) | --- (JH6) | “Open-and-shut” |
Case no. . | VH− gene* . | CDR3 (n-DH-n) . | 5′-JH . | Molecular mechanisms . |
|---|---|---|---|---|
| 99 | VH1-69 | gatcggcggTTGTACTAATGGTGTATGCT (DH2-8) | AAC (JH5) | |
| VH3-52 | gaggct---------------------- (DH2-8) | ---(JH5) | VH-VH replacement | |
| 177 | VH3-11 | agagaccctgaacggTATTTTGACTGGTTATTA (DH3-9) | TTT (JH4) | |
| VH4-39 | cggatg------------------------------ (DH3-9) | ---(JH4) | VH-VH replacement | |
| 190 | VH3-13 | gatcgggagaAT (AGC) 3TGaGATATTGTAGTGGTGGTAGCTGCTAC (DH2-15) | TAC (JH6) | |
| VH1-3 | gatggccc------------------------ (DH2-15) | --- (JH6) | VH-DJH joining | |
| 246 | VH3-74 | gtcgattGGATATTGTAGTAGTACCAGCTGCTAT (DH2-2) | TAC (JH6) | |
| VH1-2 | tcacggacaacgcgacag----------------------- (DH2-2) | ---(JH6) | VH-DJH joining | |
| 266 | VH1-46 | gaaactctaggctaactcggta (n=22 bp) | TGA (JH4) | |
| VH5-51 | cgaaaaa---------------------- (n=29 bp) | --- (JH4) | VH-NJH joining | |
| 269 | VH3-48 | GATATTGTAGTAGTACCAGCTGCTA (DH2-2) | AAC (JH5) | |
| VH4-34 | ggcggacc------------------- (DH2-2) | --- (JH5) | VH-DJH joining | |
| 392 | VH3-23 | ggccgccctacgGTATTACTATGATAGTAGTGGTTATcgg (DH3-22) | CTA (JH4) | |
| VH4-30 | gcccct--------------------------- (DH3-22) | --- (JH4) | VH-DJH joining | |
| 400 | VH4-28 | aatttcttcCTATGATAGTAGTGGTTATTAaaaggggg (DH3-22) | TGG (JH5) | |
| VH3-13 | tggggggg-------------------------- (DH3-22) | --- (JH5) | VH-DJH joining | |
| 214 | VH3-30 | cTAGTAGTACCAGCTGCTATtttggtcggggtg (DH2-2) | ACT (JH6) | |
| VH3-30 | gagggtaggttt-------------------------------- (DH2-2) | --- (JH6) | “Open-and-shut” |
For case 99 and case 177, DHJH regions were conserved but VH segment was replaced by the other VH segment, demonstrating a VH-VH replacement mechanism. For case 190, 1 sequence used VH3-13, 2 DH (DH6-13 and DH2-15) and JH6 segment, but in the other sequence VH1-3 is attached to the identical DH2-15-JH6 region. For case 246, 2 sequences shared the identical DH2-2-JH6 region but were attached to 2 different VH segments (VH3-34 and VH1-2). In case 266, 22 nucleotides in the N region and the JH4 segment were preserved but attached to different VH segments (VH1-46 and VH5-51). For cases 269, 392, and 400, an identical DHJH complex was conserved but attached to 2 different VH segments. Sequence analysis in these 6 cases demonstrates a VH-DHJH joining mechanism. Case 214 presented with 2 sequences that used the same V, D, and J segment but introduced 12 nucleotides in V-D joining with 1 C nucleotide deletion, indicating that an “open-and-shut” mechanism was involved in this case.
CDR indicates complementarity-determining region; bp, base pairs.
Identity to VH germ line genes was 99% to 100%.