Table 3

HLA-SNP haplotype content

SNP haplotype
International Histocompatibility Workshop (IHW) reference cell number10 
rs915654*rs2075800rs429916HLA haplotype
A*11:01-C*04:01-B*35:01-DRB1*01:01-DQB1*05:01 09006 
A*02:01-C*05:01-B*44:02-DRB1*04:01-DQB1*03:01 09090 
A*68:02-C*04:01-B*53:01-DRB1*15:03-DQB1*06:02 09010 
A*02:01-C*01:02-B*27:05-DRB1*01:01-DQB1*05:01 09004 
A*02:01-C*14:02-B*51:01-DRB1*08:03-DQB1*03:01 09070 
A*31:01-C*04:01-B*35:01-DRB1*04:01-DQB1*03:01 09025 
A*01:01-C*07:01-B*08:01-DRB1*03:01-DQB1*02:01 09022, 09023, 09086, 09088 
A*03:01-C*07:02-B*07:02-DRB1*15:01-DQB1*06:02 09013, 09017, 09081, 09318 
SNP haplotype
International Histocompatibility Workshop (IHW) reference cell number10 
rs915654*rs2075800rs429916HLA haplotype
A*11:01-C*04:01-B*35:01-DRB1*01:01-DQB1*05:01 09006 
A*02:01-C*05:01-B*44:02-DRB1*04:01-DQB1*03:01 09090 
A*68:02-C*04:01-B*53:01-DRB1*15:03-DQB1*06:02 09010 
A*02:01-C*01:02-B*27:05-DRB1*01:01-DQB1*05:01 09004 
A*02:01-C*14:02-B*51:01-DRB1*08:03-DQB1*03:01 09070 
A*31:01-C*04:01-B*35:01-DRB1*04:01-DQB1*03:01 09025 
A*01:01-C*07:01-B*08:01-DRB1*03:01-DQB1*02:01 09022, 09023, 09086, 09088 
A*03:01-C*07:02-B*07:02-DRB1*15:01-DQB1*06:02 09013, 09017, 09081, 09318 

A total of 163 homozygous individuals were characterized for 12 SNPs of clinical significance. The table shows one representative haplotype for each of the 3 SNP haplotypes defined by rs915654, rs2075800, and rs429916 which were each associated with transplant outcome through the patient’s genotype. A full listing of the 12 SNPs among homozygous individuals is provided in supplemental Table 2.

*

SNP rs915654 was PCR-amplified from 50 ng genomic DNA (0.42 μM of CAGCTCCAACCCCTCTAACA forward and CCTGCTGATACCCTCCAAAG reverse primers; 1× Apex Hot Start Master Mix [Genesee Scientific]) following 15 min at 95°C activation; 30 s at 95°C denaturation, 30 s at 60°C annealing, 2 min at 72°C extension for 30 cycles; 7 min at 72°C extension, and 4°C hold. Amplified products were sequenced with BigDye Terminator v.3.1 Cycle Sequencing kits and the 3730XL DNA analyzer (Applied Biosystems, Foster City, CA).

IHW09070, IHW09086, and IHW09088 were heterozygous at rs429916.

or Create an Account

Close Modal
Close Modal