Table 3.

DNA sequence of vector/human genome junctions in the repopulating cell from mouse 7.23

Integrant
site no.
PCR fragment sizeGenomic sizeGenomic sequenceBLAST search
391 bp 279 bp AAGAGCGAGATTCTTGTCTCAAAAAAAAAA… human BRCA1 (chr 17)  
205 bp 93 bp AATAAGTGTATATATACACAA… human chr 2  
188 bp 76 bp AAAGGGCACAAGAGCTAACAT… human chr 3  
139 bp 27 bp GACAGTCCATTTATACTCTTCCAAATT human chr 16  
138 bp 26 bp CAGAGCATCATCTGTGAGTTCTAATT human chr 22 
Integrant
site no.
PCR fragment sizeGenomic sizeGenomic sequenceBLAST search
391 bp 279 bp AAGAGCGAGATTCTTGTCTCAAAAAAAAAA… human BRCA1 (chr 17)  
205 bp 93 bp AATAAGTGTATATATACACAA… human chr 2  
188 bp 76 bp AAAGGGCACAAGAGCTAACAT… human chr 3  
139 bp 27 bp GACAGTCCATTTATACTCTTCCAAATT human chr 16  
138 bp 26 bp CAGAGCATCATCTGTGAGTTCTAATT human chr 22 

Sequencing reactions were performed on the 5 vector integration site bands extracted from gel in Figure 2 using a primer from within the vector extending outward into the genomic DNA. Integration site sequences were then compared to known genomic sequence databases by Basic Local Alignment Search Tool (BLAST) search to determine the precise location of the vector integrant in the human genome. Interestingly, one vector sequence showed a vector had integrated into intron 17 of a known tumor-suppressor gene, BRCA1.

or Create an Account

Close Modal
Close Modal