DNA sequence of vector/human genome junctions in the repopulating cell from mouse 7.23
Integrant site no. . | PCR fragment size . | Genomic size . | Genomic sequence . | BLAST search . |
---|---|---|---|---|
1 | 391 bp | 279 bp | AAGAGCGAGATTCTTGTCTCAAAAAAAAAA… | human BRCA1 (chr 17) |
2 | 205 bp | 93 bp | AATAAGTGTATATATACACAA… | human chr 2 |
3 | 188 bp | 76 bp | AAAGGGCACAAGAGCTAACAT… | human chr 3 |
4 | 139 bp | 27 bp | GACAGTCCATTTATACTCTTCCAAATT | human chr 16 |
5 | 138 bp | 26 bp | CAGAGCATCATCTGTGAGTTCTAATT | human chr 22 |
Integrant site no. . | PCR fragment size . | Genomic size . | Genomic sequence . | BLAST search . |
---|---|---|---|---|
1 | 391 bp | 279 bp | AAGAGCGAGATTCTTGTCTCAAAAAAAAAA… | human BRCA1 (chr 17) |
2 | 205 bp | 93 bp | AATAAGTGTATATATACACAA… | human chr 2 |
3 | 188 bp | 76 bp | AAAGGGCACAAGAGCTAACAT… | human chr 3 |
4 | 139 bp | 27 bp | GACAGTCCATTTATACTCTTCCAAATT | human chr 16 |
5 | 138 bp | 26 bp | CAGAGCATCATCTGTGAGTTCTAATT | human chr 22 |
Sequencing reactions were performed on the 5 vector integration site bands extracted from gel in Figure 2 using a primer from within the vector extending outward into the genomic DNA. Integration site sequences were then compared to known genomic sequence databases by Basic Local Alignment Search Tool (BLAST) search to determine the precise location of the vector integrant in the human genome. Interestingly, one vector sequence showed a vector had integrated into intron 17 of a known tumor-suppressor gene, BRCA1.