Complement levels of 4 patients with ticlopidine TMAs and corresponding mutations
| Patient code . | C5a (ng/mL) (normal range, 0.3-70) . | sC5b-9 (ng/mL) (normal range, 100-300) . | CFH polymorphism . |
|---|---|---|---|
| 010 | 32.08 | 4862 | Homozygous exon 18 E936D |
| 022 | 51.21 | 6023 | Heterozygous exon 18 Q950H |
| 003 | 27.74 | 5904 | Heterozygous exon 18 E936D |
| 012 | 50.96 | 6229 | Heterozygous exon 19 N1050Y |
| Patient code . | C5a (ng/mL) (normal range, 0.3-70) . | sC5b-9 (ng/mL) (normal range, 100-300) . | CFH polymorphism . |
|---|---|---|---|
| 010 | 32.08 | 4862 | Homozygous exon 18 E936D |
| 022 | 51.21 | 6023 | Heterozygous exon 18 Q950H |
| 003 | 27.74 | 5904 | Heterozygous exon 18 E936D |
| 012 | 50.96 | 6229 | Heterozygous exon 19 N1050Y |
Primers used are exon 18 first step TAGACAGACAGACACCAGAAGG (forward), GGTACCACTTACACTTTGAATGAAGA (reverse); exon 18 second step AATTTATGAGTTAGTGAAACCTGAAT (forward), GGTACCACTTACACTTTGAATGAAGA (reverse); exon 19 first step TGTGTAATCTCAATTGCTACGGCT (forward), GGCTGGGCCCACACATTA (reverse); and exon 19 second step ACAAAATGGCTAATATATTTTCTCAAG (forward), GGCTGGGCCCACACATTA (reverse).
CFH, complement factor H.